جستجوی پیشرفته...

جامع ترین مرکز مبادلات

مواد شیمیایی

مواد بیولوژیک

لوازم و تجهیزات آزمایشگاهی

مشخصات آگهی



پرایمر آلفا کریستالین مستقیم و معکوس

Primer alpha crystalin (F and R)

 شرکت سازنده:

metabion international AG


100 میکرولیتر (100 pmol)


50,000 تومان

 تاریخ انقضاء:

 حالت/ویژگی شاخص:

استفاده شده



 شرایط نگهداری:

دمای 20-


از کار پایان نامه باقی مانده است. OD=6.92 Tm (F)= 60 (ACGACCACGGCTACATTTCC) Tm (R)= 63 (GGCTGCTCTCTCAAACCCTC) SIZE:350bp

 کلمات کلیدی:

آگهی فروش


40% تخفیف
https://www.iranelab.com/pictures\default_image/iranelab.jpg https://www.iranelab.com/pictures\default_image/iranelab.jpg https://www.iranelab.com/pictures\default_image/iranelab.jpg

شما میتوانید با تکمیل فرم زیر برای این اگهی درخواست پیش فاکتور کنید

فرم درخواست پیش فاکتور

مقالات مرتبط 1

اطلاعات تماس

 نام آگهی دهنده:

دکتر میکائیلی

 تلفن تماس:





میدان حافظ خیابان مصطفی خمینی کوچه شهید پناهدار بن بست گلفام پلاک 3
در زمان تماس با اگهی دهنده نام ایران ایلب را عنوان کنید تا در صورت تخفیف از آن بهره مند شوید

آگهی های منتخب

هیچ موردی یافت نشد


گزارش تخلف

کاربر گرامی در صورتی که از نظر شما محتوای این آگهی مغایر با شئونات اخلاقی و اسلامی است، میتوانید متن اعتراض خود را در کادر زیر وارد نموده و روی دکمه ثبت تخلف کلیک کنید تا در اسرع وقت به آن رسیدگی شود

متن گزارش:(300 کارکتر) 

ثبت تخلف

فرم درخواست پیش فاکتور
تلفن تماس:  
متن درخواست:  

ایران ایلب

: جامع ترین مرکز مبادلات مواد شیمیایی ، بیولوژیک، لوازم و تجهیزات آزمایشگاهی

کلیه حقوق مادی و معنوی این وب سایت متعلق به شرکت فناوران دانش گستر حکیم می باشد و حق نشر محفوظ است . طراحی و پیاده سازی توسط گروه نرم افزاری MEM